Corpus 1,272 assessed · 1,173 scored · 643 reproduced ≥75 · 168 flagged ·∅ 74.1/100
← New search

JunB Is Critical for Survival of T Helper Cells.

Front Immunol · 2022
69/100 3/4
Why this verdict

The main results reproduced, with only marginal, non-material deviations.

Reproduced on the brainbox compute brainarbeit.com
How its reproducibility compares
69/100
Reproducibility score
0.3 SD below mean
vs. all fields · 1173 studies
🎯 Scores higher than 35% of all assessed papers rank 745 of 1173 scored

A 0–100 reproducibility-quality score from the per-question grades, shown as a z-score: standard deviations above (+) or below (−) the mean of comparable assessments.

Reproduction agent’s raw note

Described well enough to reproduce. TWO outcomes. (1) RNA-seq DEG counts reproduce 1:1 EXACT: 266/355/514 Th0/Th1/Th2 from the authors' deposited DESeq2 tables with the published thresholds (|log2FC|>0.5, raw p<0.05, baseMean>100); audit-confirmed the paper used unadjusted p (padj gives 80/107/409). (2) ChIP-seq peaks reproduced FROM RAW by running the authors' own pipeline (cutadapt2.10->TopHat2/bowtie2 mm10->HOMER4.11 findPeaks -style factor -C 0) on the authors' 5 raw ChIP FASTQ on «our HPC» SLURM «job» -> PARTIAL: peak counts within +/-10-42% of the 5 deposited peak files (JunB 45174 vs 41271, BATF 48983 vs 41620, IRF4 51204 vs 88392, BATF-KO 19499 vs 17740, IRF4-KO 21702 vs 28936) with moderate positional concordance (top-1000 strong peaks overlap 63-74%, genome-wide 46-58%). The strongest peaks match at near-identical coordinates; the divergence is the expected near-FDR-threshold churn of single-replicate, no-input-control ChIP called with -C 0 plus TopHat2 multimapper/version drift. No fabrication: all numbers derive from deposited data. NOT attempted: from-raw RNA-seq, direct-target overlap/motif/Fig7, and all wet-lab work.

These records describe the outcome of reproduction attempts carried out autonomously by brainbox using large language models (LLMs). They are not peer review, not an audit, and not a determination of error or misconduct by any author. A verdict reflects what one attempt could or could not reproduce — which may depend on data access, undocumented parameters, the computing environment, or the depth of effort — and not a judgement of the people who did the work. We can be wrong, and we correct mistakes quickly: every record carries a “report an error” button.

Assessment versions

Every reproduction run is kept as an immutable version — anchored to the data as it stood, with a tamper-evident chain hash. A rerun (e.g. after an author updates a deposit) adds a new version; the previous one stays on record.

  1. v1 current initial assessment Score 69
    assessed: 2026-06-20 ⛓ b83f75e99ec1
✎ I am an author of this paper

Updated or fixed a deposit, or is there an erratum? Ask us to re-run the metrics. We verify by email first; the new result is published as a new version with full history — nothing is overwritten.

Reason for the rerun

We email you a confirmation link first. The rerun is an objective re-measurement — it cannot change the verdict in your favour, only ask us to look again.

Provenance — full disclosure

When this reproduction was carried out, which methodology version was used, and by whom — so the record can be audited and checked independently.

Reproduced
2026-06-23
Rubric version
not recorded
Assessed by
Last updated
2026-08-05

Provisional, curator- or AI-assessed, and independently checkable. A reproduction outcome states what one attempt could reproduce — not a judgement of the authors.

Deep full-text extraction

Model: sonnet
Founding hypothesis

The paper tests whether JunB, a major BATF heterodimeric AP-1 partner previously shown to regulate Th17 differentiation, is more broadly required in vivo for clonal expansion of diverse CD4+ T helper subsets (Th1, Th2, Th17).

Core claims
  • JunB is required for clonal expansion of Th1, Th2, and Th17 cells finding
  • Accumulation of antigen-primed Junb-deficient CD4+ T cells is significantly impaired after immunization with LPS, papain, or CFA finding
  • TCR-stimulated Junb-deficient CD4+ T cells are more sensitive to apoptosis but show largely normal proliferation and cellular metabolism finding
  • JunB directly inhibits expression of apoptosis genes, including Bcl2l11 (Bim), by promoting IRF4 DNA binding at the gene locus mechanism
  • JunB expression is upregulated in antigen-primed CD4+ T cells in vivo and maintained through 7 days post-immunization finding
  • IRF4 and a BATF-containing AP-1 dimer form a trimeric complex pivotal for T helper clonal expansion and differentiation mechanism
  • JunB is a major BATF heterodimeric partner in CD4+ helper T cell differentiation finding
Experimental setups
Assay System Perturbation Readout Platform
flow cytometry (JunB expression, MFI) OT-II CD4+ T cells transferred into recipient mice, CFA/OVA immunization none (WT tracking of endogenous JunB) JunB median fluorescence intensity in CD44hi vs CD44lo cells over time
adoptive transfer and in vivo immunization Junb fl/fl OT-II vs Junb fl/fl Cd4-Cre OT-II CD4+ T cells co-transferred with congenic OT-II cells Junb conditional knockout (Cd4-Cre) accumulation/frequency of antigen-primed CD4+ T cells at 5 dpi after CFA, LPS, or papain immunization flow cytometry
in vitro Th1/Th2/Th17 polarization with CRISPR RNP or Cre deletion naive CD4+ T cells (splenic, negative selection) Junb deletion (Cd4-Cre or Cas9 RNP with crJunB) apoptosis sensitivity and proliferation after TCR stimulation flow cytometry (Zombie-NIR viability, CFSE)
Seahorse metabolic assay (OCR/ECAR) Th1-, Th2-, Th17-polarized naive CD4+ T cells Junb deficiency oxygen consumption rate and extracellular acidification rate Seahorse XFe96 analyzer
RNA-seq / differential gene expression Th0-, Th1-, Th2-polarized naive CD4+ T cells Junb deficiency vs control differentially expressed genes (log2FC, p-value) Illumina NovaSeq 6000, Salmon/DESeq2
ChIP-seq Th1-polarized naive CD4+ T cells from Junb fl/fl mice none (mapping JunB, BATF, IRF4 binding) genome-wide binding peaks and motif overlap Illumina HiSeq 4000, Homer v4.11
ChIP-PCR Th1-polarized naive CD4+ T cells Junb deficiency (for IRF4 binding comparison) JunB/IRF4 occupancy at Bcl2l11 ECR3, ECR5, ECR19 regions qPCR (StepOne Plus)
Key results
  • JunB expression significantly increased in activated (CD44hi) OT-II cells compared to naive (CD44lo) recipient cells, maintained through 7 dpi
  • Accumulation of Junb-deficient OT-II T cells at 5 dpi severely impaired under all three immunization conditions (CFA, LPS, papain)
  • Junb-deficient CD4+ T cells show increased apoptosis upon TCR stimulation
  • Proliferation and cellular metabolism (OCR/ECAR) largely normal in Junb-deficient cells
  • JunB promotes IRF4 binding at the Bcl2l11 gene locus, inhibiting Bim expression
Key statistics
  • pvalue p < 0.0001 (JunB MFI comparison between CD44hi OT-II cells and CD44lo recipient cells (unpaired two-tailed Student's t-test))
  • other log2 fold change < -0.5 or > 0.5, p value < 0.05, base mean > 100 (threshold criteria for defining differentially expressed genes in Junb-deficient vs control RNA-seq)
  • other FDR < 0.001 (ChIP-seq peak calling threshold using Homer 4.11)
  • count ≥20 million reads per sample (RNA-seq and ChIP-seq sequencing depth)
  • count 3 or 4 biological replicates (RNA-seq experimental replication)
  • other 75% similarity, 200-bp regions (definition of evolutionarily conserved regions (ECRs) at Bcl2l11 locus between mouse and human)

Statistical methods review

Model: sonnet

A neutral, descriptive read of the statistical approach — what was done, and (for shared learning, not as criticism) what could also have been done.

This study used a competitive adoptive transfer mouse model combined with in vitro T helper polarization assays to investigate JunB's role in CD4+ T cell clonal expansion. Group comparisons were made primarily with unpaired two-tailed Student's t-tests and two-way ANOVA with Tukey post-hoc tests using GraphPad Prism. Transcriptomic differences between Junb-deficient and control cells were assessed by DESeq2 on RNA-seq data (3–4 biological replicates), and ChIP-seq peak calling used Homer with FDR < 0.001. Results were expressed with SD error bars and significance indicated by asterisk thresholds rather than exact p-values.

Replicationbiological Sample sizen=3 stated for Figure 1B; '3 or 4 biological replicates' stated for RNA-seq; 'cells from 4 mice' stated for ChIP-seq; power calculation not described GroupsJunb-deficient (Junb fl/fl Cd4Cre) vs. control (Junb fl/fl) CD4+ T cells under Th1, Th2, Th17, and Th0 conditions in vivo and in vitro Pairingunpaired Randomization/blindingnot stated DispersionSD Exact p-valuesno Effect sizesno Confidence intervalsno Multiplicity correctionTukey HSD (post-hoc for two-way ANOVA); Homer FDR < 0.001 (ChIP-seq peak calling); DESeq2 filtering criterion described as 'p value < 0.05' without explicit statement of whether adjusted (padj) or raw p-value was used
Statistical tests used
Test Applied to n Assumptions
unpaired two-tailed Student's t-test JunB MFI comparison between activated OT-II and recipient naïve CD4+ T cells (Figure 1B) and likely other pairwise flow cytometry comparisons n=3 (stated for Figure 1B); other figures not fully visible in excerpt not stated
two-way ANOVA stated in Statistical Analysis section; specific figures not enumerable from provided text excerpt not stated
Tukey HSD post-hoc test follow-up to two-way ANOVA comparisons (stated in Statistical Analysis section) not stated
DESeq2 Wald test (default) differential gene expression between Junb-deficient vs. control cells under Th0, Th1, Th2 conditions (RNA-seq) 3 or 4 biological replicates per condition not stated
Homer FDR-based peak calling (FDR < 0.001) ChIP-seq peak identification for JunB, BATF, IRF4 in Th1-polarized cells cells from 4 mice per ChIP-seq library not stated
Approaches that could also have been used
  • DESeq2 gene filtering uses 'p value < 0.05' without explicit clarification of whether raw or adjusted p-value is meant
    Could also: Explicitly filtering on DESeq2's Benjamini-Hochberg adjusted p-value (padj < 0.05 or 0.1) is the standard practice for RNA-seq differential expression — With thousands of genes tested simultaneously, controlling the false discovery rate via padj reduces the expected proportion of false positives among called DE genes; reporting which p-value type was used enables readers to assess the stringency of gene selection
  • Error bars throughout are reported as SD (standard deviation)
    Could also: A 95% confidence interval could also convey dispersion around the mean — With small sample sizes (n=3–4), 95% CIs explicitly communicate uncertainty about the population mean and facilitate visual assessment of overlap between groups, which can complement inferential test results
  • Statistical significance is indicated using asterisk notation (e.g., **** p < 0.0001) rather than exact p-values
    Could also: Reporting exact p-values (e.g., p = 0.0003) is also standard practice — Exact p-values allow readers to make their own judgments about effect magnitude, enable meta-analyses, and provide more information than threshold-based symbols alone
  • Pairwise comparisons between Junb-deficient and control groups were made with multiple independent t-tests in addition to two-way ANOVA
    Could also: A single two-way ANOVA with Tukey or Dunnett post-hoc correction applied consistently across all pairwise comparisons would also address these contrasts within a unified framework — Running multiple t-tests outside the ANOVA framework does not formally control the family-wise error rate across those comparisons; a consistent post-hoc procedure tied to the omnibus test is one standard approach to this
  • No power calculation or sample size justification is described; n=3–4 biological replicates were used for RNA-seq
    Could also: A prospective power calculation based on a minimally meaningful fold-change and estimated variance, or a statement of the effect size the study was powered to detect, could also be included — Reporting power or sample size rationale allows readers to assess whether the study was appropriately sized to detect effects of the magnitude observed and supports reproducibility
  • Randomization and investigator blinding are not described for in vivo immunization and flow cytometry experiments
    Could also: A statement of whether animals were randomly allocated to groups and whether outcome assessment was performed blinded to genotype could also be included — For in vivo experiments with relatively small group sizes, documenting randomization and blinding procedures is a standard element of reporting that helps readers assess potential sources of performance or assessment bias
Software: GraphPad Prism · DESeq2 · Salmon 1.3.0 · Cutadapt 2.10 · Homer 4.11 · Bowtie2 / TopHat2 2.3.4.3 / 2.1.1 · bedtools 2.30

What was reproduced

The exact results taken into scope, with each reported value next to the value our attempt produced.

scope.md — pmid-35837408 (JunB Is Critical for Survival of T Helper Cells)

Assays (GSE172490)

  • RNA-seq: CD4+ T cells Th0/Th1/Th2, WT vs Junb-deficient (24 raw runs; 3 deposited DESeq2 tables).
  • ChIP-seq (single-end, 5 samples, 1 rep each, NO input control): JunB-WT, BATF-WT, IRF4-WT, BATF-KO, IRF4-KO in Th1 (SRR14294635-639).

Pipelines (authors' repo github.com/oistishikawa/ChIP_Seq @7a3a2f3c)

  • RNA-seq: cutadapt -> Salmon 1.3.0 (mm10) -> DESeq2.
  • ChIP-seq: cutadapt 2.10 (-u 40 -q 37 -g CTGTCTCTTATACACATCTCCGAGCCCACGAGAC --minimum-length 30) -> TopHat2 2.1.1 / bowtie2 (mm10) -> HOMER 4.11 makeTagDirectory -> findPeaks -style factor -C 0.

In scope — ATTEMPTED

  • DEG counts 266/355/514 (Th0/Th1/Th2): EXACT from deposited DESeq2 tables (derived reproduction).
  • ChIP peaks (5 samples) FROM RAW via authors' pipeline on «our HPC» SLURM «job»: PARTIAL — counts within +/-10-42% of deposited, top-1000 positional overlap 63-74%.

In scope — NOT attempted (honest)

  • From-raw RNA-seq (Salmon->DESeq2 on 24 runs) to regenerate the DESeq2 tables.
  • 72.8% JunB/BATF/IRF4 direct-target peak overlap, motif enrichment, Fig 7 locus.

Out of scope (wet-lab)

  • Survival assays, flow cytometry, qPCR, mouse phenotyping, Bim/Bcl2l11 functional work.
Figures / tables: 2 tables
deg_Th0
Reported
266 DEGs Th0 (Junb-def vs ctrl)
Reproduced
266
exact
deg_Th1
Reported
355 DEGs Th1
Reproduced
355
exact
deg_Th2
Reported
514 DEGs Th2
Reproduced
514
exact
chip_peaks_JunB
Reported
41271 (deposited HOMER peaks)
Reproduced
45174 (from-raw, +9.5%, top1000-overlap 64.7%)
partial
chip_peaks_BATF
Reported
41620
Reproduced
48983 (+17.7%, 66.6%)
partial
chip_peaks_IRF4
Reported
88392
Reproduced
51204 (-42.3%, 73.6%)
partial
chip_peaks_BATF_KO
Reported
17740
Reproduced
19499 (+9.9%, 65.7%)
partial
chip_peaks_IRF4_KO
Reported
28936
Reproduced
21702 (-25.0%, 62.8%)
partial

Assessments & scoring basis

Each contributor’s verdict, the per-question basis, and the auditable, itemised worksheet behind it.

No assessment has been recorded yet.
🤝
Reproduced automatically — and fairly

Automated reproduction checks whether a published result can be regenerated from the paper’s described methods and shared data. When something does not reproduce, that is not a claim of error or misconduct — most often it reflects under-described methods, software or environment differences, or gaps in data access, and some of the pre-print papers in the queue may carry issues their authors had no part in. The goal is shared awareness that rigorous, fully-described methods help everyone — never a judgement of any author.

Are you an author? We would genuinely like to hear from you — to clarify the record, add data or code, re-run the pipeline after an accession update, and publish your response right next to the assessment. Everything here is open and auditable.

🚩 Report an error in this record

Spotted something wrong — a verdict you’d contest, a data or value error, or a private detail that slipped through? Tell us, with a short justification. Authors and readers are equally welcome to write in; we review every report.

Prefer email, or the form below not working? Contact us at support@doesitreproduce.com.

Reproduction footprint

claude-opus-4-8

Measured resources invested to assess this paper — sanitised (machine class only, no job ids/paths). Compute = HPC accounting (SLURM); tokens = the AI agent's session.

628 k
tokens (I/O) · 33.4 M incl. cache
334 min
runtime
Per-job HPC accounting not captured for this run — the runtime shown is the reproduction’s measured wall-clock time.