JunB Is Critical for Survival of T Helper Cells.
The main results reproduced, with only marginal, non-material deviations.
A 0–100 reproducibility-quality score from the per-question grades, shown as a z-score: standard deviations above (+) or below (−) the mean of comparable assessments.
▸Reproduction agent’s raw note
Described well enough to reproduce. TWO outcomes. (1) RNA-seq DEG counts reproduce 1:1 EXACT: 266/355/514 Th0/Th1/Th2 from the authors' deposited DESeq2 tables with the published thresholds (|log2FC|>0.5, raw p<0.05, baseMean>100); audit-confirmed the paper used unadjusted p (padj gives 80/107/409). (2) ChIP-seq peaks reproduced FROM RAW by running the authors' own pipeline (cutadapt2.10->TopHat2/bowtie2 mm10->HOMER4.11 findPeaks -style factor -C 0) on the authors' 5 raw ChIP FASTQ on «our HPC» SLURM «job» -> PARTIAL: peak counts within +/-10-42% of the 5 deposited peak files (JunB 45174 vs 41271, BATF 48983 vs 41620, IRF4 51204 vs 88392, BATF-KO 19499 vs 17740, IRF4-KO 21702 vs 28936) with moderate positional concordance (top-1000 strong peaks overlap 63-74%, genome-wide 46-58%). The strongest peaks match at near-identical coordinates; the divergence is the expected near-FDR-threshold churn of single-replicate, no-input-control ChIP called with -C 0 plus TopHat2 multimapper/version drift. No fabrication: all numbers derive from deposited data. NOT attempted: from-raw RNA-seq, direct-target overlap/motif/Fig7, and all wet-lab work.
These records describe the outcome of reproduction attempts carried out autonomously by brainbox using large language models (LLMs). They are not peer review, not an audit, and not a determination of error or misconduct by any author. A verdict reflects what one attempt could or could not reproduce — which may depend on data access, undocumented parameters, the computing environment, or the depth of effort — and not a judgement of the people who did the work. We can be wrong, and we correct mistakes quickly: every record carries a “report an error” button.
Assessment versions
Every reproduction run is kept as an immutable version — anchored to the data as it stood, with a tamper-evident chain hash. A rerun (e.g. after an author updates a deposit) adds a new version; the previous one stays on record.
-
v1 current initial assessment Score 69assessed: 2026-06-20 ⛓ b83f75e99ec1
✎ I am an author of this paper
Updated or fixed a deposit, or is there an erratum? Ask us to re-run the metrics. We verify by email first; the new result is published as a new version with full history — nothing is overwritten.
Provenance — full disclosure
When this reproduction was carried out, which methodology version was used, and by whom — so the record can be audited and checked independently.
- Reproduced
- 2026-06-23
- Rubric version
- not recorded
- Assessed by
- —
- Last updated
- 2026-08-05
Provisional, curator- or AI-assessed, and independently checkable. A reproduction outcome states what one attempt could reproduce — not a judgement of the authors.
Deep full-text extraction
Model: sonnetThe paper tests whether JunB, a major BATF heterodimeric AP-1 partner previously shown to regulate Th17 differentiation, is more broadly required in vivo for clonal expansion of diverse CD4+ T helper subsets (Th1, Th2, Th17).
- ★ JunB is required for clonal expansion of Th1, Th2, and Th17 cells finding
- ★ Accumulation of antigen-primed Junb-deficient CD4+ T cells is significantly impaired after immunization with LPS, papain, or CFA finding
- ★ TCR-stimulated Junb-deficient CD4+ T cells are more sensitive to apoptosis but show largely normal proliferation and cellular metabolism finding
- ★ JunB directly inhibits expression of apoptosis genes, including Bcl2l11 (Bim), by promoting IRF4 DNA binding at the gene locus mechanism
- ★ JunB expression is upregulated in antigen-primed CD4+ T cells in vivo and maintained through 7 days post-immunization finding
- IRF4 and a BATF-containing AP-1 dimer form a trimeric complex pivotal for T helper clonal expansion and differentiation mechanism
- JunB is a major BATF heterodimeric partner in CD4+ helper T cell differentiation finding
| Assay | System | Perturbation | Readout | Platform |
|---|---|---|---|---|
| flow cytometry (JunB expression, MFI) | OT-II CD4+ T cells transferred into recipient mice, CFA/OVA immunization | none (WT tracking of endogenous JunB) | JunB median fluorescence intensity in CD44hi vs CD44lo cells over time | — |
| adoptive transfer and in vivo immunization | Junb fl/fl OT-II vs Junb fl/fl Cd4-Cre OT-II CD4+ T cells co-transferred with congenic OT-II cells | Junb conditional knockout (Cd4-Cre) | accumulation/frequency of antigen-primed CD4+ T cells at 5 dpi after CFA, LPS, or papain immunization | flow cytometry |
| in vitro Th1/Th2/Th17 polarization with CRISPR RNP or Cre deletion | naive CD4+ T cells (splenic, negative selection) | Junb deletion (Cd4-Cre or Cas9 RNP with crJunB) | apoptosis sensitivity and proliferation after TCR stimulation | flow cytometry (Zombie-NIR viability, CFSE) |
| Seahorse metabolic assay (OCR/ECAR) | Th1-, Th2-, Th17-polarized naive CD4+ T cells | Junb deficiency | oxygen consumption rate and extracellular acidification rate | Seahorse XFe96 analyzer |
| RNA-seq / differential gene expression | Th0-, Th1-, Th2-polarized naive CD4+ T cells | Junb deficiency vs control | differentially expressed genes (log2FC, p-value) | Illumina NovaSeq 6000, Salmon/DESeq2 |
| ChIP-seq | Th1-polarized naive CD4+ T cells from Junb fl/fl mice | none (mapping JunB, BATF, IRF4 binding) | genome-wide binding peaks and motif overlap | Illumina HiSeq 4000, Homer v4.11 |
| ChIP-PCR | Th1-polarized naive CD4+ T cells | Junb deficiency (for IRF4 binding comparison) | JunB/IRF4 occupancy at Bcl2l11 ECR3, ECR5, ECR19 regions | qPCR (StepOne Plus) |
- ▲ JunB expression significantly increased in activated (CD44hi) OT-II cells compared to naive (CD44lo) recipient cells, maintained through 7 dpi
- ▼ Accumulation of Junb-deficient OT-II T cells at 5 dpi severely impaired under all three immunization conditions (CFA, LPS, papain)
- ▲ Junb-deficient CD4+ T cells show increased apoptosis upon TCR stimulation
- – Proliferation and cellular metabolism (OCR/ECAR) largely normal in Junb-deficient cells
- – JunB promotes IRF4 binding at the Bcl2l11 gene locus, inhibiting Bim expression
- pvalue p < 0.0001 (JunB MFI comparison between CD44hi OT-II cells and CD44lo recipient cells (unpaired two-tailed Student's t-test))
- other log2 fold change < -0.5 or > 0.5, p value < 0.05, base mean > 100 (threshold criteria for defining differentially expressed genes in Junb-deficient vs control RNA-seq)
- other FDR < 0.001 (ChIP-seq peak calling threshold using Homer 4.11)
- count ≥20 million reads per sample (RNA-seq and ChIP-seq sequencing depth)
- count 3 or 4 biological replicates (RNA-seq experimental replication)
- other 75% similarity, 200-bp regions (definition of evolutionarily conserved regions (ECRs) at Bcl2l11 locus between mouse and human)
Statistical methods review
Model: sonnetA neutral, descriptive read of the statistical approach — what was done, and (for shared learning, not as criticism) what could also have been done.
This study used a competitive adoptive transfer mouse model combined with in vitro T helper polarization assays to investigate JunB's role in CD4+ T cell clonal expansion. Group comparisons were made primarily with unpaired two-tailed Student's t-tests and two-way ANOVA with Tukey post-hoc tests using GraphPad Prism. Transcriptomic differences between Junb-deficient and control cells were assessed by DESeq2 on RNA-seq data (3–4 biological replicates), and ChIP-seq peak calling used Homer with FDR < 0.001. Results were expressed with SD error bars and significance indicated by asterisk thresholds rather than exact p-values.
| Test | Applied to | n | Assumptions |
|---|---|---|---|
| unpaired two-tailed Student's t-test | JunB MFI comparison between activated OT-II and recipient naïve CD4+ T cells (Figure 1B) and likely other pairwise flow cytometry comparisons | n=3 (stated for Figure 1B); other figures not fully visible in excerpt | not stated |
| two-way ANOVA | stated in Statistical Analysis section; specific figures not enumerable from provided text excerpt | — | not stated |
| Tukey HSD post-hoc test | follow-up to two-way ANOVA comparisons (stated in Statistical Analysis section) | — | not stated |
| DESeq2 Wald test (default) | differential gene expression between Junb-deficient vs. control cells under Th0, Th1, Th2 conditions (RNA-seq) | 3 or 4 biological replicates per condition | not stated |
| Homer FDR-based peak calling (FDR < 0.001) | ChIP-seq peak identification for JunB, BATF, IRF4 in Th1-polarized cells | cells from 4 mice per ChIP-seq library | not stated |
-
DESeq2 gene filtering uses 'p value < 0.05' without explicit clarification of whether raw or adjusted p-value is meant↳ Could also: Explicitly filtering on DESeq2's Benjamini-Hochberg adjusted p-value (padj < 0.05 or 0.1) is the standard practice for RNA-seq differential expression — With thousands of genes tested simultaneously, controlling the false discovery rate via padj reduces the expected proportion of false positives among called DE genes; reporting which p-value type was used enables readers to assess the stringency of gene selection
-
Error bars throughout are reported as SD (standard deviation)↳ Could also: A 95% confidence interval could also convey dispersion around the mean — With small sample sizes (n=3–4), 95% CIs explicitly communicate uncertainty about the population mean and facilitate visual assessment of overlap between groups, which can complement inferential test results
-
Statistical significance is indicated using asterisk notation (e.g., **** p < 0.0001) rather than exact p-values↳ Could also: Reporting exact p-values (e.g., p = 0.0003) is also standard practice — Exact p-values allow readers to make their own judgments about effect magnitude, enable meta-analyses, and provide more information than threshold-based symbols alone
-
Pairwise comparisons between Junb-deficient and control groups were made with multiple independent t-tests in addition to two-way ANOVA↳ Could also: A single two-way ANOVA with Tukey or Dunnett post-hoc correction applied consistently across all pairwise comparisons would also address these contrasts within a unified framework — Running multiple t-tests outside the ANOVA framework does not formally control the family-wise error rate across those comparisons; a consistent post-hoc procedure tied to the omnibus test is one standard approach to this
-
No power calculation or sample size justification is described; n=3–4 biological replicates were used for RNA-seq↳ Could also: A prospective power calculation based on a minimally meaningful fold-change and estimated variance, or a statement of the effect size the study was powered to detect, could also be included — Reporting power or sample size rationale allows readers to assess whether the study was appropriately sized to detect effects of the magnitude observed and supports reproducibility
-
Randomization and investigator blinding are not described for in vivo immunization and flow cytometry experiments↳ Could also: A statement of whether animals were randomly allocated to groups and whether outcome assessment was performed blinded to genotype could also be included — For in vivo experiments with relatively small group sizes, documenting randomization and blinding procedures is a standard element of reporting that helps readers assess potential sources of performance or assessment bias
What was reproduced
The exact results taken into scope, with each reported value next to the value our attempt produced.
scope.md — pmid-35837408 (JunB Is Critical for Survival of T Helper Cells)
Assays (GSE172490)
- RNA-seq: CD4+ T cells Th0/Th1/Th2, WT vs Junb-deficient (24 raw runs; 3 deposited DESeq2 tables).
- ChIP-seq (single-end, 5 samples, 1 rep each, NO input control): JunB-WT, BATF-WT, IRF4-WT, BATF-KO, IRF4-KO in Th1 (SRR14294635-639).
Pipelines (authors' repo github.com/oistishikawa/ChIP_Seq @7a3a2f3c)
- RNA-seq: cutadapt -> Salmon 1.3.0 (mm10) -> DESeq2.
- ChIP-seq: cutadapt 2.10 (-u 40 -q 37 -g CTGTCTCTTATACACATCTCCGAGCCCACGAGAC --minimum-length 30) -> TopHat2 2.1.1 / bowtie2 (mm10) -> HOMER 4.11 makeTagDirectory -> findPeaks -style factor -C 0.
In scope — ATTEMPTED
- DEG counts 266/355/514 (Th0/Th1/Th2): EXACT from deposited DESeq2 tables (derived reproduction).
- ChIP peaks (5 samples) FROM RAW via authors' pipeline on «our HPC» SLURM «job»: PARTIAL — counts within +/-10-42% of deposited, top-1000 positional overlap 63-74%.
In scope — NOT attempted (honest)
- From-raw RNA-seq (Salmon->DESeq2 on 24 runs) to regenerate the DESeq2 tables.
- 72.8% JunB/BATF/IRF4 direct-target peak overlap, motif enrichment, Fig 7 locus.
Out of scope (wet-lab)
- Survival assays, flow cytometry, qPCR, mouse phenotyping, Bim/Bcl2l11 functional work.
Assessments & scoring basis
Each contributor’s verdict, the per-question basis, and the auditable, itemised worksheet behind it.
Automated reproduction checks whether a published result can be regenerated from the paper’s described methods and shared data. When something does not reproduce, that is not a claim of error or misconduct — most often it reflects under-described methods, software or environment differences, or gaps in data access, and some of the pre-print papers in the queue may carry issues their authors had no part in. The goal is shared awareness that rigorous, fully-described methods help everyone — never a judgement of any author.
Are you an author? We would genuinely like to hear from you — to clarify the record, add data or code, re-run the pipeline after an accession update, and publish your response right next to the assessment. Everything here is open and auditable.
🚩 Report an error in this record
Spotted something wrong — a verdict you’d contest, a data or value error, or a private detail that slipped through? Tell us, with a short justification. Authors and readers are equally welcome to write in; we review every report.
Prefer email, or the form below not working? Contact us at support@doesitreproduce.com.
Reproduction footprint
claude-opus-4-8Measured resources invested to assess this paper — sanitised (machine class only, no job ids/paths). Compute = HPC accounting (SLURM); tokens = the AI agent's session.